ID: 999072375_999072379

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 999072375 999072379
Species Human (GRCh38) Human (GRCh38)
Location 5:148759447-148759469 5:148759469-148759491
Sequence CCTGAAATCTAGAGATCTCAGGA AAGGTATTCTTGACTATGGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 10, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!