ID: 999104223_999104225

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 999104223 999104225
Species Human (GRCh38) Human (GRCh38)
Location 5:149055458-149055480 5:149055509-149055531
Sequence CCACAATGGAACACAACTACACA GATAAAGCCAAGTGTTTGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 145, 4: 1160} {0: 1, 1: 1, 2: 6, 3: 43, 4: 395}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!