ID: 999138850_999138853

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 999138850 999138853
Species Human (GRCh38) Human (GRCh38)
Location 5:149343594-149343616 5:149343624-149343646
Sequence CCTTAACAAGGAAGCAAAAGAAA CTAAGAAACTAAAAGGGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 88, 4: 1043} {0: 1, 1: 0, 2: 0, 3: 13, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!