ID: 999146585_999146588

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 999146585 999146588
Species Human (GRCh38) Human (GRCh38)
Location 5:149399969-149399991 5:149399992-149400014
Sequence CCTTCCTGCTTCTTCACAGTAGC TACTGGCAAGCACCCCTATATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 40}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!