ID: 999153783_999153790

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 999153783 999153790
Species Human (GRCh38) Human (GRCh38)
Location 5:149443732-149443754 5:149443753-149443775
Sequence CCTCCCACCCACTTCTGAAAAGG GGATTTCAGATGGTTTAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 268} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!