ID: 999193767_999193773

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 999193767 999193773
Species Human (GRCh38) Human (GRCh38)
Location 5:149768060-149768082 5:149768103-149768125
Sequence CCAGTCTCCTCCGTAATCTTGTT AAACCCTGCTTCACAGGGATAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 10, 3: 22, 4: 150} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!