ID: 999297101_999297107

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 999297101 999297107
Species Human (GRCh38) Human (GRCh38)
Location 5:150466459-150466481 5:150466509-150466531
Sequence CCAGGCATGGTGGTTCATGTCTA TAGGAGCATTGCTGAAGCCCAGG
Strand - +
Off-target summary {0: 9, 1: 181, 2: 3482, 3: 24786, 4: 73853} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!