ID: 999297104_999297107

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 999297104 999297107
Species Human (GRCh38) Human (GRCh38)
Location 5:150466486-150466508 5:150466509-150466531
Sequence CCCAACACTTTGGAAGGCTGAGA TAGGAGCATTGCTGAAGCCCAGG
Strand - +
Off-target summary {0: 25, 1: 1137, 2: 18680, 3: 131334, 4: 244514} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!