ID: 999297105_999297107

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 999297105 999297107
Species Human (GRCh38) Human (GRCh38)
Location 5:150466487-150466509 5:150466509-150466531
Sequence CCAACACTTTGGAAGGCTGAGAT TAGGAGCATTGCTGAAGCCCAGG
Strand - +
Off-target summary {0: 14, 1: 481, 2: 7615, 3: 56053, 4: 163738} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!