ID: 999369871_999369879

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 999369871 999369879
Species Human (GRCh38) Human (GRCh38)
Location 5:151048179-151048201 5:151048221-151048243
Sequence CCGGGGAAGGAGGAAGAGGGTGG TGCACCCTGAACCTCCGCGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 13, 3: 146, 4: 1024} {0: 1, 1: 0, 2: 1, 3: 5, 4: 55}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!