ID: 999444671_999444673

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 999444671 999444673
Species Human (GRCh38) Human (GRCh38)
Location 5:151629798-151629820 5:151629846-151629868
Sequence CCTTTTGCATGAGTTACCTACTC AAGAAGAAGAAGAAAGAAGAAGG
Strand - +
Off-target summary No data {0: 16, 1: 101, 2: 331, 3: 1363, 4: 7127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!