ID: 999512920_999512923

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 999512920 999512923
Species Human (GRCh38) Human (GRCh38)
Location 5:152271566-152271588 5:152271599-152271621
Sequence CCACACAAATATCTACTTTTCCT AAAGCAATGCTGACACCCAGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!